4th International AIDS Conference


Stockholm, Sweden. — June 12-16, 1988


[TITLE:] SEQUENCE SIMILARITIES BETWEEN HIV-1 AND A PUTATIVE HUMAN LYMPHOCYTE GO/Gl SWITCH GENE

Int Conf AIDS. 1988 Jun 12-16;4:1.118 (abstract no. 1021)

Donald R. Forsdyke
Department of Biochemistry, Queen's University, Kingston, Ontario, Canada, K7L 3N6


OBJECTIVE: Entry of host T-cells into the GI phase of the cell cycle is necessary for productive infection with HIV. We wished to examine whether latent HIV and the genes regulating the entry of GO "latent" lymphocytes into G1 share common elements (e.g. sites for binding NFκ B which increases in GI cells; Nabel & Baltimore, Nature. 1987 Apr 16-22;326(6114):711-3).

METHODS: Differentially hybridizing cDNA recombinants corresponding to GO/G1 switch genes were isolated (Forsdyke DR, Biochem Biophys Res Commun. 1985 Jun 28;129(3):619-25) and sequenced.

RESULTS:. Recombinant no.7 (c-fos) and recombinants no.19 and 24 (unidentified) contained, in a small AT-rich 3' non-coding region, the TTATTTAT element characteristic of certain lymphokine genes and proto-oncogenes (Shaw & Kamen, Cell. 1986 Aug 29;46(5):659-67). There were also similarities with the TTRNNNTTTTTT element (Renan, Biosci Rep. 1986 Sep;6(9):819-25). The region containing this element in recombinant no.19 (TAGTTTTTGTAATTTATTTTC) differed by only a purine transition from the HIV-1 pol gene(3' coding region). Nearby is the sequence GGGACTCTTC which shows similarity to the HIV-1 enhancer, a site of NFκ B-binding.

CONCLUSION: These results suggest that expression of latent HIV-1 might be regulated by factors which recognize sequences common to "latent" host GO/GI regulatory genes and to HIV. The HIV pol. similarity implies that the 3' coding region of the latter gene serves both a coding and a signal-recognition function. This might confer the codon usage bias recently reported by Kypr J & Mrazek J, Nature. 1987 May 7-13;327(6117):20.

Supported by the American Foundation for AIDS Research.

880612
1021

Copyright © 1988 - International AIDS Society (IAS). Reproduction of this abstract (other than one copy for personal reference) must be cleared through the IAS.