AEGiS-15IAC: Genetic subtyping of HIV1 strains circulating in India by PCR-RFLP of protease gene amplicon.

15th International AIDS Conference

Bangkok, Thailand - July 11-16, 2004

Genetic subtyping of HIV1 strains circulating in India by PCR-RFLP of protease gene amplicon.

Int Conf AIDS 2004 Jul 11-16; 15:(abstract no. TuOrA1144)

Sahni AK, Seth P, Gupta RM, Bhardwaj JR, Prasad VV
Armed Forces Medical College, Pune, India

BACKGROUND: Rapidly evolving viruses such as HIV-1 develop marked sequence differences in their genome over course of epidemic and in individuals infected for longer duration. Best strategy for controlling the menace of HIV remains development of efficacious prophylactic vaccine using the most appropriate (antigenically related) strain. This requires information regarding subtypes of most likely challenge strains found regionally.

METHODS: HIV-1 subtypes were determined by PCR-RFLP of the protease gene amplicon in HIV-1 seropositive individuals. 15 samples were included whose genomic subtypes were known by Heteroduplex Mobility Assay (HMA). A 297 bp protease (pol) gene fragment was amplified by nested PCR using the inner round primers consisting of DP16 (5'- CCTCAAATCACTCTTTGGCAAC 3') and DP17 (5'- AAAATTTAAAGTGCAGCCAAT 3') and the outer set of primers, consisting DP10 (5'- CAACTCCCTCTCAGAAGCAGGAGCCG 3') and DP11 (5'- CCATTCCTGGCTTTAATTTTACTGGTA 3'). The 297 bp amplicon was cloned in PCR- Script Amp SK (+) cloning vector. The positive clones were selected by Pvu II digestion of plasmid DNA of these clones. Preliminary classification of HIV-1 strains to well-defined subtypes was done by sequential endonuclease restriction analysis by Alu 1, Bcl1, Hinf1, and Sca1. The restriction digest was set up with total volume of 20*l, consisting of 10*l of pol gene amplified product and 1*l of the restriction enzyme (10U/ *l) with 1*l of the (1X) specific enzyme buffer, supplied by the manufacturer.

RESULTS: The subtype distribution of the 15 samples studied were, Subtype C= 12, subtype B=2 and homotypic C2 & C3 recombinant=1.

CONCLUSIONS: PCR-RFLP as a method of sub typing HIV-1 is fast, reliable and inexpensive. Determination of HIV-1 subtypes has significant implications for development of a candidate vaccine for India.

Keywords: AEGIS, HIV-1, Polymorphism, Restriction Fragment Length, Polymerase Chain Reaction, Genes, pol, Acquired Immunodeficiency Syndrome, HIV Seropositivity, HIV-1 Reverse Transcriptase, India, genetics

040711
TuOrA1144